Journal: Journal of Cell Science

Article Title: High-content tripartite split-GFP cell-based assays to screen for modulators of small GTPase activation

doi: 10.1242/jcs.210419

Figure Lengend Snippet: Characterization of a split-GFP reporter of small-GTPase activation. (A) Design of the reporter system. The GTPase is fused to the C-terminus of GFP10 and the cognate binding domain of the GTPase effector (GBD) to the N-terminus of GFP11. When the GTPase is activated (GTP-bound), interaction with the effector domain occurs, enabling complementation with GFP1-9 and formation of reconstituted full-length GFP (rGFP). (B) Localization of the indicated GFP10–Rho and GFP10–Ras mutants in HEK_GFP1-9 cells (anti-GFP10 immunostaining). L63 and V12 mutants are constitutively active; N19 and N17 mutants are dominant negative. Scale bars: 10 µm. (C) FACS analysis of active GFP10–RhoA (L63) and inactive GFP10–RhoA (N17) mutants with the GFP11-tagged Rho-binding domain of Rhotekin (RBD-11). Representative dot plots show the gating strategy to quantify GFP fluorescence from the global population and from the cell population positive for GFP10 and GFP11 immunostaining (GFP10+ GFP11+). The histograms on the left show the percentage of GFP-positive cells relative to untransfected cells in the global population. See also Fig. S2 . (D) Quantification of split-GFP fluorescence in the GFP10+GFP11+ region from HEK_GFP1-9 cells co-transfected with the indicated GFP10–Rho and GFP10–HRas variants and the respective GTPase binding domain of their effector. RsBD-11, H-Ras-binding domain of c-Raf1. Results are mean±s.e.m.; n =3 independent experiments. * P <0.05, ** P <0.01 (paired Student's t -test). (E) Correlation between the percentage of GFP fluorescent cells in the global population and the mean GFP fluorescence intensity of GFP10 and GFP11 co-expressing cells for the set of GTPase–effector interactions tested above. (F) Representative confocal microscopy images of Rho–RBD and Ras–RsBD interactions leading to fluorescence of rGFP, as well as immunofluorescence from anti-GFP10 (cyan, GTPase) and anti-GFP11 (magenta, GBD) antibody staining. Scale bar: 10 µm.

Article Snippet: The tet-on inducible bidirectional promoter lentiviral vector (Lv. pTRIP TRE-BI GFP10-Rho/RBD-GFP11) was generated by subcloning the RBD-GFP11 cassette from a pTRE tight BI vector (Clontech) into the MLuI site of an HIV-1-based lentiviral pTrip vector carrying a tetracycline response element (TRE) (BIVIC platform, IFR 150, CHU Rangueil, Toulouse, France) (see Fig. S4A ).

Techniques: Activation Assay, Binding Assay, Immunostaining, Dominant Negative Mutation, Fluorescence, Transfection, Expressing, Confocal Microscopy, Immunofluorescence, Staining

Journal: Journal of Cell Science

Article Title: High-content tripartite split-GFP cell-based assays to screen for modulators of small GTPase activation

doi: 10.1242/jcs.210419

Figure Lengend Snippet: An anti-GFP nanobody binds to the rGFP and boosts split-GFP fluorescence. (A) Left panels, representative images of GFP1-9 localization (anti-GFPNt antibody staining, gray) for GFP1-9 variants targeted to the nucleus (NLS), cytoplasm (NES) and the plasma membrane (CAAX). Localization of the anti-GFP VHH nanobody (anti-Myc staining, red) with GFP1-9 variants alone (middle panels), and in the presence of a self-assembling GFP10–RBD–GFP11 (10-R-11) domain that induces split-GFP complementation (right panels). Scale bars: 10 μm. (B) Quantification of split-GFP fluorescence intensity of MRC5-SV_GFP1-9 cells expressing (+) or not (−) the VHH domain and transfected with the indicated constructs: interacting leucine zippers (10Z+Z11), non-interacting 10HRas and RBD11, and GFP1-9 self-associating domains [GFP10–Zipper–GFP11 (10-Z-11) and GFP10–RBD–GFP11 (10-R-11)]. U, untransfected cells. Mean fluorescence intensity was quantified in GFP10+GFP11+ expressing cells after double immunostaining with anti-GFP10 and anti-GFP11 antibodies; full-length eGFP fluorescence was collected in the whole cell population. Results are mean±s.e.m.; n =3 independent experiments. # P <0.0001; ns, not significant (multiple t -tests using the Holm–Sidak method with α=5%).

Article Snippet: The tet-on inducible bidirectional promoter lentiviral vector (Lv. pTRIP TRE-BI GFP10-Rho/RBD-GFP11) was generated by subcloning the RBD-GFP11 cassette from a pTRE tight BI vector (Clontech) into the MLuI site of an HIV-1-based lentiviral pTrip vector carrying a tetracycline response element (TRE) (BIVIC platform, IFR 150, CHU Rangueil, Toulouse, France) (see Fig. S4A ).

Techniques: Fluorescence, Staining, Expressing, Transfection, Construct, Double Immunostaining

Journal: Journal of Cell Science

Article Title: High-content tripartite split-GFP cell-based assays to screen for modulators of small GTPase activation

doi: 10.1242/jcs.210419

Figure Lengend Snippet: triSFP RhoB activation reporter cell model. (A) A bidirectional inducible promoter vector co-expressing GFP10–Rho and RBD–GFP11 chimera was used to transduce MRC5-SV fibroblasts expressing the GFP1-9 fragment and the VHH anti-GFP nanobody. Binding of the nanobody to rGFP enhances its fluorescence. (B) Doxycycline dose–response rGFP fluorescence in MRC5_GFP1-9 in the presence (+VHH) or in the absence (−VHH) of the anti-GFP intrabody. Results are mean±s.e.m.; n =3 independent experiments. # P <0.0001; ns, not significant (Holm–Sidak t -test with α=5%). Control of protein expression is shown in the western blot below the graph (anti-GFP10 and anti-GFP11 antibodies; anti-Myc for VHH). (C) Flow cytometry analysis of serum-induced activation. RhoB activation reporter was expressed with 2.5 µg/ml doxycycline (Dox+), and the cell line was subjected or not to serum stimulation (4 h) after a starvation period of 48 h (T0). Results are mean±s.e.m.; n =3 independent experiments. * P <0.05 (paired Student's t -test). The immunoblot below the graph shows GFP10–RhoB and RBD–GFP11 expression for the indicated conditions. (D) Single-cell analysis of RhoB activation by time-lapse microscopy. Plot of the ratio of cellular mean fluorescence intensity (MFI) to basal MFI measured at T0 (MFI T0 ) for serum-starved and serum-stimulated cells [ n =20 cells from four (serum stimulation) and five (serum starvation) independent experiments; mean±s.e.m.]. An enlargement is shown on the right for serum-stimulated condition (0–240 min).

Article Snippet: The tet-on inducible bidirectional promoter lentiviral vector (Lv. pTRIP TRE-BI GFP10-Rho/RBD-GFP11) was generated by subcloning the RBD-GFP11 cassette from a pTRE tight BI vector (Clontech) into the MLuI site of an HIV-1-based lentiviral pTrip vector carrying a tetracycline response element (TRE) (BIVIC platform, IFR 150, CHU Rangueil, Toulouse, France) (see Fig. S4A ).

Techniques: Activation Assay, Plasmid Preparation, Expressing, Transduction, Binding Assay, Fluorescence, Western Blot, Flow Cytometry, Single-cell Analysis, Time-lapse Microscopy

Journal: Journal of Cell Science

Article Title: High-content tripartite split-GFP cell-based assays to screen for modulators of small GTPase activation

doi: 10.1242/jcs.210419

Figure Lengend Snippet: Analysis of modulation of RhoB activity. (A) Experimental workflow used to evaluate inhibitors of Rho activation by using the triSFP Rho reporter system; inhibitors or siRNAs were added prior to split-GFP expression. A decrease in split-GFP fluorescence will report either a decrease of the amount of the active GTP-Rho form or the inhibition of the Rho–RBD interaction. (B) Dose–response inhibition of the RhoB reporter with TAT-C3 exoenzyme (0.1 to 25 µg/ml). The mean fluorescence intensity was analyzed by flow cytometry. Results are mean±s.e.m.; n =3. As shown in the blot underneath the graph, an analysis of RhoB expression (anti-GFP10) confirmed the ADP-ribosylation (rib.) of RhoB that induces a shift of the RhoB band. (C) Percentage of GFP fluorescent cells for RhoB reporter cells left untransfected (U) or transfected with scrambled siRNA (siCtrl) or siRNA targeting the RhoGEF VAV2 (siVAV2). Results are mean±s.e.m.; n =3 independent experiments. ** P <0.01 (Student's t -test). Expression of VAV2 and triSFP components is shown below (anti-GFP10 and anti-GFP11 antibodies; GFP1-9, antibody against full-length GFP). (D) Representative images of untransfected (U), siCtrl and siVAV2-transfected cells visualized by fluorescence microscopy. Left, wide-field images of cells expressing active RhoB (FITC channel); DAPI nuclear staining. Scale bars: 50 µm. Right, representative confocal images of RhoB-GTP and actin labeling (Phalloidin–Alexa-Fluor-594). Scale bars: 10 µm.

Article Snippet: The tet-on inducible bidirectional promoter lentiviral vector (Lv. pTRIP TRE-BI GFP10-Rho/RBD-GFP11) was generated by subcloning the RBD-GFP11 cassette from a pTRE tight BI vector (Clontech) into the MLuI site of an HIV-1-based lentiviral pTrip vector carrying a tetracycline response element (TRE) (BIVIC platform, IFR 150, CHU Rangueil, Toulouse, France) (see Fig. S4A ).

Techniques: Activity Assay, Activation Assay, Expressing, Fluorescence, Inhibition, Flow Cytometry, Transfection, Microscopy, Staining, Labeling

Journal: Journal of Cell Science

Article Title: High-content tripartite split-GFP cell-based assays to screen for modulators of small GTPase activation

doi: 10.1242/jcs.210419

Figure Lengend Snippet: RhoA activation with microtubule drugs. (A) A RhoA activation reporter cell line was engineered to analyze RhoA activation upon treatment with microtubule poisons in a 96-well format. GFP intensity kinetic curves show modulation of RhoA activation upon treatment with indicated compounds (mean of three independent acquisitions). Middle graph, nocodazole shows the strongest induction of GFP fluorescence ( y -axis shows arbitrary units), highlighting the increase of split-GFP fluorescence early after stimulation. The bar graph on the right shows the final GFP fluorescence value for each condition. Results are mean±s.e.m.; n =3, * P <0.05, ** P <0.01 (Student's t -test). (B) Representative confocal images of split-GFP fluorescence (FITC channel), α-tubulin (gray) and RhoA expression (anti-GFP10, magenta) for the indicated treatments. Scale bars: 40 µm.

Article Snippet: The tet-on inducible bidirectional promoter lentiviral vector (Lv. pTRIP TRE-BI GFP10-Rho/RBD-GFP11) was generated by subcloning the RBD-GFP11 cassette from a pTRE tight BI vector (Clontech) into the MLuI site of an HIV-1-based lentiviral pTrip vector carrying a tetracycline response element (TRE) (BIVIC platform, IFR 150, CHU Rangueil, Toulouse, France) (see Fig. S4A ).

Techniques: Activation Assay, Fluorescence, Expressing

Journal:

Article Title: Anomalous Surface Distribution of Glycosyl Phosphatidyl Inositol–anchored Proteins in Neurons Lacking Acid Sphingomyelinase

doi: 10.1091/mbc.E07-05-0439

Figure Lengend Snippet: RhoA membrane targeting and activation is impaired in ASMKO neurons, and its overexpression restores PrPC internalization. (A) Western blot of the total extracts and membrane pellets from wt and ASMKO mice brains using antibodies against RhoA, cdc42, and tubulin. Graphs show mean values from three independent experiments of RhoA or cdc42 levels normalized to the amount of tubulin expressed as percentage over wt values (*p < 0.05). (B) Western blot of the total extracts, the Rhotekin-bound or the Pak1-PBD bound samples from wt and ASMKO mice brains using the antibody against RhoA or cdc42, respectively. Graphs show mean values from three independent experiments of the levels of RhoA or cdc42 in total extracts and of the amount of Rhotekin-bound RhoA or Pak1-PBD bound cdc42 normalized to the amount of RhoA or cdc42, respectively, in the total extracts. Data are expressed as percentage over the wt values (**p < 0.005). (C) Western blot of the total extract and membrane pellets from cultured neurons treated or not with SM using antibodies against RhoA and tubulin. Graph shows mean values from three independent experiments of RhoA levels normalized to the amount of tubulin expressed as percentage over wt values (*p < 0.05). (D) Representative confocal image of ASMKO neurons transfected (arrow) or not (arrowhead) with the RhoA active form (L63) after 10-min internalization of PrPC antibody. Z value indicates in μm the depth of the stack shown. Graphs show quantitative analysis of 15 transfected and 15 nontransfected neurons from each of three independent cultures. Data are expressed as mean value and SD of the number of PrPC positive intracellular structures per cell body area unit or as total fluorescence intensity in arbitrary units (**p < 0.005; ***p < 0.001).

Article Snippet: RhoA Overexpression ASMKO neurons were transfected at day 8 in vitro with the active form of RhoA (L63) cloned into the BamHI-EcoRI site of the pmRFPC1 vector using the Effectene kit (Qiagen, Santa Clarita, CA).

Techniques: Membrane, Activation Assay, Over Expression, Western Blot, Cell Culture, Transfection, Fluorescence

Journal: Cancer discovery

Article Title: Gain-of-Function RHOA Mutations Promote Focal Adhesion Kinase Activation and Dependency in Diffuse Gastric Cancer

doi: 10.1158/2159-8290.CD-19-0811

Figure Lengend Snippet: A, E. coli-expressed RHOA proteins were evaluated in vitro. Intrinsic guanine nucleotide exchange activity (n = 3). B, Recombinant ECT2 DH-PH catalytic domain stimulation of RHOA nucleotide exchange activity (n = 3). Intrinsic RHOA GTP hydrolysis activity was determined by (C, D) directly measuring RHOA bound GTP levels (n = 4) or (E, F) based on phosphate release using the phosphate binding protein sensor (n = 2). G, Determination of p190RhoGAP catalytic domain stimulation of RHOA GTP hydrolysis activity using the phosphate binding protein sensor (n = 2). Data in A-G are mean ± S.E.M.; ***P<0.001, **P<0.01, *P<0.05, ns, not significant; unpaired t-test. H, RHOA guanine nucleotide binding was determined in NIH/3T3 cells expressing the indicated RHOA proteins by 32P-metabolic labeling (n = 2). Data are mean ± S.E.M., ***P<0.001, ns, not significant; one-way ANOVA with Tukey’s multiple comparison test. I, Normalized binding affinities of RHOA WT and Y42C to RBD domains of indicated effectors, as determined in effector-nucleotide dissociation assays; nb = binding too weak to be detected (n = 3). All affinities were normalized to RHOA WT binding to each effector. Data are mean ± S.E.M.; ***P<0.001, ns, not significant; unpaired t-test. J, Comparison of WT and mutant RHOA biochemical properties.

Article Snippet: Sequencing-confirmed pGV-RHOA Y42C vectors were co-electroporated with plasmid expressing FLP recombinase into mouse ES cells (MESC10, Mirimus) engineered with a FLP homing cassette at Co1A1 locus, and positive clones were identified by PCR.

Techniques: In Vitro, Activity Assay, Recombinant, Binding Assay, Expressing, Labeling, Mutagenesis

Journal: Journal of Neuroscience Research

Article Title: Tomosyn regulates the small RhoA GTPase to control the dendritic stability of neurons and the surface expression of AMPA receptors

doi: 10.1002/jnr.24608

Figure Lengend Snippet: Knockdown of tomosyn reduces dendritic complexity and dendritic spine density. (a) Representative images and reconstructed dendritic trees from mouse hippocampal neurons transfected with scrambled shRNA + GFP or shTomosyn + GFP or shTomosyn + Tom r ‐GFP. Scale bar, 100 µm. (b) Sholl analysis, (c) branch number, and (d) total dendrite length of reconstructed neurons. General dendrite complexity was quantified by the area under the Sholl curve. Neurons expressing shTomosyn exhibited compromised dendritic complexity, whereas expression of Tom r ‐GFP rescued simplified dendritic complexity in shTomosyn‐expressing neurons compared to scramble controls. * p < 0.05, **** p < 0.0001, one‐way ANOVA with Tukey's test. n = 26 scramble, 28 shTomosyn, and 27 Tomosyn rescue. (e) Confocal images of dendritic spines from neurons transfected with scrambled shRNA + GFP, shTomosyn + GFP, or shTomosyn + Tom r ‐GFP for 72 hr. Scale bar, 2 µm. (f) Mean spine density was decreased in tomosyn knockdown neurons at primary, secondary, and tertiary dendrites. Spine density was restored in Tom r ‐GFP rescue and shTomosyn co‐expressing neurons compared to shTomosyn + GFP. * p < 0.05, *** p < 0.001, **** p < 0.0001 by two‐way ANOVA with Tukey's test multiple comparisons test. n = 15 scramble, 14 shTomosyn, and 15 Tomosyn rescue [Color figure can be viewed at https://www.wileyonlinelibrary.com ]

Article Snippet: The shRNA‐resistant tomosyn (wild‐type WT r ‐Tom‐GFP, L412V r ‐Tom‐GFP, and Y502C r ‐Tom‐GFP) constructs were made by mutating three nucleotides in the shTomosyn sequences with two PCR primers: Forward 5′‐AGTGGCTCTATGTGGGCACGGAACGCGGAAACATACACATTGTTA‐3′ and Reverse 5′‐TAACAATGTGTATGTTTCCGCGTTCCGTGCCCACATAGAGCCACT‐3′. shTomosyn‐WT r ‐Tom‐RFP, shTomosyn‐L412V r ‐Tom‐RFP, and shTomosyn‐Y502C r ‐Tom‐RFP were generated by inserting WT r ‐Tom, L412V r ‐Tom, or Y502C r ‐Tom into the shTomosyn vector. pcDNA3‐EGFP‐RhoA‐WT (Addgene, plasmid # 12965) and pcDNA3‐EGFP‐RhoA‐T19N (Addgene, plasmid # 12967) were gifts from Gary Bokoch (Subauste et al., ). pCI‐SEP‐GluR1 (Addgene, plasmid #24000) was a gift from Robert Malinow (Kopec, Li, Wei, Boehm, & Malinow, ). pTriEx‐RhoA FLARE.sc Biosensor WT (Addgene, plasmid # 12150) was a gift from Klaus Hahn (Pertz, Hodgson, Klemke, & Hahn, ). pCAGIG (IRES‐GFP; Addgene, plasmid # 11159) was a gift from Connie Cepko (Matsuda & Cepko, ). pRFP‐N1 was constructed by replacing GFP in the pEGFP‐N1 (Clontech, Catalog # 6085‐1) with RFP.

Techniques: Knockdown, Transfection, shRNA, Expressing

Journal: Journal of Neuroscience Research

Article Title: Tomosyn regulates the small RhoA GTPase to control the dendritic stability of neurons and the surface expression of AMPA receptors

doi: 10.1002/jnr.24608

Figure Lengend Snippet: Frequency of miniature EPSCs is decreased in tomosyn knockdown neurons. Cultured hippocampal neurons were transfected with either scrambled shRNA or shTomosyn. (a) An example of current traces collected from whole‐cell voltage‐clamp of hippocampal neurons. (b) Examples of average (top) and scaled (bottom) mEPSC traces from scrambled shRNA and shTomosyn transfected neurons. Summary graphs show (c) frequency, (d) amplitude, (e) charge, and (f) decay time constant of recorded mEPSCs. * p < 0.05, **** p < 0.0001, Student's t‐ test. n = 22 scramble and 21 shTomosyn [Color figure can be viewed at https://www.wileyonlinelibrary.com ]

Article Snippet: The shRNA‐resistant tomosyn (wild‐type WT r ‐Tom‐GFP, L412V r ‐Tom‐GFP, and Y502C r ‐Tom‐GFP) constructs were made by mutating three nucleotides in the shTomosyn sequences with two PCR primers: Forward 5′‐AGTGGCTCTATGTGGGCACGGAACGCGGAAACATACACATTGTTA‐3′ and Reverse 5′‐TAACAATGTGTATGTTTCCGCGTTCCGTGCCCACATAGAGCCACT‐3′. shTomosyn‐WT r ‐Tom‐RFP, shTomosyn‐L412V r ‐Tom‐RFP, and shTomosyn‐Y502C r ‐Tom‐RFP were generated by inserting WT r ‐Tom, L412V r ‐Tom, or Y502C r ‐Tom into the shTomosyn vector. pcDNA3‐EGFP‐RhoA‐WT (Addgene, plasmid # 12965) and pcDNA3‐EGFP‐RhoA‐T19N (Addgene, plasmid # 12967) were gifts from Gary Bokoch (Subauste et al., ). pCI‐SEP‐GluR1 (Addgene, plasmid #24000) was a gift from Robert Malinow (Kopec, Li, Wei, Boehm, & Malinow, ). pTriEx‐RhoA FLARE.sc Biosensor WT (Addgene, plasmid # 12150) was a gift from Klaus Hahn (Pertz, Hodgson, Klemke, & Hahn, ). pCAGIG (IRES‐GFP; Addgene, plasmid # 11159) was a gift from Connie Cepko (Matsuda & Cepko, ). pRFP‐N1 was constructed by replacing GFP in the pEGFP‐N1 (Clontech, Catalog # 6085‐1) with RFP.

Techniques: Knockdown, Cell Culture, Transfection, shRNA

Journal: Journal of Neuroscience Research

Article Title: Tomosyn regulates the small RhoA GTPase to control the dendritic stability of neurons and the surface expression of AMPA receptors

doi: 10.1002/jnr.24608

Figure Lengend Snippet: Tomosyn knockdown results in increased RhoA activity in hippocampal neurons. Hippocampal neurons were co‐transfected with a RhoA biosensor and either scrambled shRNA or shTomosyn. (a) Representative images show the neurons in the intensity‐modulated display mode. Higher magnification of the soma and a dendritic segment in dashed box areas are enlarged for better visualization. Scale bar, 20 and 5 µm. (b) FRET efficiency was determined as a ratio of YFP/CFP. **** p < 0.0001, unpaired Student's t ‐test. n = 72 scramble and 69 shTomosyn. (c) Schematic structure of domain mutant tomosyn. FL‐Tom, full‐length mouse tomosyn (1‐1166 aa); Tom‐ΔC, containing an N‐terminal domain with WD40 repeats (1‐1048 aa); Tom‐ΔN, containing a SNARE coil‐coiled domain (1049‐1109 aa). (d) Western blot shows the expression of domain mutant tomosyn (Tom‐ΔC‐RFP and Tom‐ΔN‐RFP), FL‐Tom‐RFP, and RFP control in N2a cells. (e) Summary graph showing FRET efficiency in domain mutant tomosyn‐expressing neurons. Neurons with Tom‐ΔN‐RFP showed increased FRET efficiency. *** p < 0.001 compared to RFP, FL‐tomosyn, and ΔC‐tomosyn, one‐way ANOVA with Dunnett's multiple comparisons test. n = 32 RFP, 28 FL‐Tom‐RFP, 29 Tom‐ΔC‐RFP, and 32 Tom‐ΔN‐RFP

Article Snippet: The shRNA‐resistant tomosyn (wild‐type WT r ‐Tom‐GFP, L412V r ‐Tom‐GFP, and Y502C r ‐Tom‐GFP) constructs were made by mutating three nucleotides in the shTomosyn sequences with two PCR primers: Forward 5′‐AGTGGCTCTATGTGGGCACGGAACGCGGAAACATACACATTGTTA‐3′ and Reverse 5′‐TAACAATGTGTATGTTTCCGCGTTCCGTGCCCACATAGAGCCACT‐3′. shTomosyn‐WT r ‐Tom‐RFP, shTomosyn‐L412V r ‐Tom‐RFP, and shTomosyn‐Y502C r ‐Tom‐RFP were generated by inserting WT r ‐Tom, L412V r ‐Tom, or Y502C r ‐Tom into the shTomosyn vector. pcDNA3‐EGFP‐RhoA‐WT (Addgene, plasmid # 12965) and pcDNA3‐EGFP‐RhoA‐T19N (Addgene, plasmid # 12967) were gifts from Gary Bokoch (Subauste et al., ). pCI‐SEP‐GluR1 (Addgene, plasmid #24000) was a gift from Robert Malinow (Kopec, Li, Wei, Boehm, & Malinow, ). pTriEx‐RhoA FLARE.sc Biosensor WT (Addgene, plasmid # 12150) was a gift from Klaus Hahn (Pertz, Hodgson, Klemke, & Hahn, ). pCAGIG (IRES‐GFP; Addgene, plasmid # 11159) was a gift from Connie Cepko (Matsuda & Cepko, ). pRFP‐N1 was constructed by replacing GFP in the pEGFP‐N1 (Clontech, Catalog # 6085‐1) with RFP.

Techniques: Knockdown, Activity Assay, Transfection, shRNA, Mutagenesis, Western Blot, Expressing, Control

Journal: Journal of Neuroscience Research

Article Title: Tomosyn regulates the small RhoA GTPase to control the dendritic stability of neurons and the surface expression of AMPA receptors

doi: 10.1002/jnr.24608

Figure Lengend Snippet: Inhibition of the Rho signaling pathway restores altered dendritic structures in tomosyn knockdown neurons. Representative images show (a) dendritic morphology at DIV7 and (b) spine morphology at DIV15. Transfected neurons were co‐expressed by scramble shRNA or IRES‐EGFP together with IRES‐EGFP (left), EGFP‐WT‐RhoA (middle), and EGFP‐T19N‐RhoA (right). Scale bar, 100 µm in a and 2 µm in b. Quantification of (c) branch number, (d) total dendrite length, and (e) spine density of neurons co‐transfected neurons. Co‐expression of T19N‐RhoA resulted in similar levels of dendritic complexity and spine density between scramble control‐ and shTomosyn‐expressing neurons. ** p < 0.01, *** p < 0.001, **** p < 0.0001, two‐way ANOVA with Sidak's multiple comparisons test. n = 27 scramble + ctrl, 35 scramble + WT‐RhoA, 34 scramble + T19N‐RhoA, 37 shTomosyn + ctrl, 35 shTomosyn + WT‐RhoA, and 36 shTomosyn + T19N‐RhoA in c and d; n = 20 scramble + ctrl, 26 scramble + WT‐RhoA, 22 scramble + T19N‐RhoA, 18 shTomosyn + ctrl, 19 shTomosyn + WT‐RhoA, 21 shTomosyn + T19N‐RhoA in e

Article Snippet: The shRNA‐resistant tomosyn (wild‐type WT r ‐Tom‐GFP, L412V r ‐Tom‐GFP, and Y502C r ‐Tom‐GFP) constructs were made by mutating three nucleotides in the shTomosyn sequences with two PCR primers: Forward 5′‐AGTGGCTCTATGTGGGCACGGAACGCGGAAACATACACATTGTTA‐3′ and Reverse 5′‐TAACAATGTGTATGTTTCCGCGTTCCGTGCCCACATAGAGCCACT‐3′. shTomosyn‐WT r ‐Tom‐RFP, shTomosyn‐L412V r ‐Tom‐RFP, and shTomosyn‐Y502C r ‐Tom‐RFP were generated by inserting WT r ‐Tom, L412V r ‐Tom, or Y502C r ‐Tom into the shTomosyn vector. pcDNA3‐EGFP‐RhoA‐WT (Addgene, plasmid # 12965) and pcDNA3‐EGFP‐RhoA‐T19N (Addgene, plasmid # 12967) were gifts from Gary Bokoch (Subauste et al., ). pCI‐SEP‐GluR1 (Addgene, plasmid #24000) was a gift from Robert Malinow (Kopec, Li, Wei, Boehm, & Malinow, ). pTriEx‐RhoA FLARE.sc Biosensor WT (Addgene, plasmid # 12150) was a gift from Klaus Hahn (Pertz, Hodgson, Klemke, & Hahn, ). pCAGIG (IRES‐GFP; Addgene, plasmid # 11159) was a gift from Connie Cepko (Matsuda & Cepko, ). pRFP‐N1 was constructed by replacing GFP in the pEGFP‐N1 (Clontech, Catalog # 6085‐1) with RFP.

Techniques: Inhibition, Knockdown, Transfection, shRNA, Expressing, Control

Journal: Journal of Neuroscience Research

Article Title: Tomosyn regulates the small RhoA GTPase to control the dendritic stability of neurons and the surface expression of AMPA receptors

doi: 10.1002/jnr.24608

Figure Lengend Snippet: Surface expression of GluR1 subunits is reduced in tomosyn knockdown neurons. (a) Western blot analysis of co‐immunoprecipitation experiments in cultured cortical neurons. Cultured cortical neuron lysates at 15 DIV were immunoprecipitated with either anti‐tomosyn antibody, rabbit IgG control, anti‐syntaxin‐4 antibody, or mouse IgG control. Immunoblot was probed with tomosyn and syntaxin‐4 antibodies. FT = flow through. Quantification of the surface expression of pHluorin‐GluR1 in (b) dendritic spines and (c) dendritic segments. Cultured neurons were co‐transfected with either Tomosyn‐RFP (OE), scrambled shRNA, or shTomosyn and pHluorin‐GluR1. Tomosyn knockdown neurons were treated with the RhoA inhibitor, C3T. * p < 0.05, *** p < 0.001, one‐way ANOVA with Dunnett's multiple comparisons test. n = 16 OE, 20 scramble, 22 shTomosyn, and 23 shTomosyn + C3T. (d) Representative confocal images showing surface staining for pHluorin‐GluR1 in cultured hippocampal neurons at 15 DIV. Scale bar, 2 µm

Article Snippet: The shRNA‐resistant tomosyn (wild‐type WT r ‐Tom‐GFP, L412V r ‐Tom‐GFP, and Y502C r ‐Tom‐GFP) constructs were made by mutating three nucleotides in the shTomosyn sequences with two PCR primers: Forward 5′‐AGTGGCTCTATGTGGGCACGGAACGCGGAAACATACACATTGTTA‐3′ and Reverse 5′‐TAACAATGTGTATGTTTCCGCGTTCCGTGCCCACATAGAGCCACT‐3′. shTomosyn‐WT r ‐Tom‐RFP, shTomosyn‐L412V r ‐Tom‐RFP, and shTomosyn‐Y502C r ‐Tom‐RFP were generated by inserting WT r ‐Tom, L412V r ‐Tom, or Y502C r ‐Tom into the shTomosyn vector. pcDNA3‐EGFP‐RhoA‐WT (Addgene, plasmid # 12965) and pcDNA3‐EGFP‐RhoA‐T19N (Addgene, plasmid # 12967) were gifts from Gary Bokoch (Subauste et al., ). pCI‐SEP‐GluR1 (Addgene, plasmid #24000) was a gift from Robert Malinow (Kopec, Li, Wei, Boehm, & Malinow, ). pTriEx‐RhoA FLARE.sc Biosensor WT (Addgene, plasmid # 12150) was a gift from Klaus Hahn (Pertz, Hodgson, Klemke, & Hahn, ). pCAGIG (IRES‐GFP; Addgene, plasmid # 11159) was a gift from Connie Cepko (Matsuda & Cepko, ). pRFP‐N1 was constructed by replacing GFP in the pEGFP‐N1 (Clontech, Catalog # 6085‐1) with RFP.

Techniques: Expressing, Knockdown, Western Blot, Immunoprecipitation, Cell Culture, Control, Transfection, shRNA, Staining

Journal: Journal of Neuroscience Research

Article Title: Tomosyn regulates the small RhoA GTPase to control the dendritic stability of neurons and the surface expression of AMPA receptors

doi: 10.1002/jnr.24608

Figure Lengend Snippet: Autism‐associated mutant tomosyn fails to restore dendritic arborization and spine loss in tomosyn knockdown neurons. (a) An illustration of the location of L412V and Y502C mutations in tomosyn. (b) Representative images of reconstructed dendritic trees and (c) Sholl analysis, (d) branch number, and (e) total dendrite length from mouse hippocampal neurons transfected with scrambled shRNA + GFP, shTomosyn + GFP, shTomosyn + WT r ‐Tom‐GFP, shTomosyn + L412V r ‐Tom‐GFP, or shTomosyn + Y502C r ‐Tom‐GFP. Scale bar, 100 µm. Both L412V and Y502C mutant tomosyn failed to rescue total dendrite length compared to scrambled shRNA. Only Y502C failed to rescue branch number compared to scramble. # p < 0.05, ## p < 0.01, ### p < 0.001, #### p < 0.0001 when compared to scramble; * p < 0.05, ** p < 0.01, **** p < 0.0001 when compared to shTomosyn, one‐way ANOVA with Tukey multiple comparisons test. n = 30 scramble, 31 shTomosyn, 27 WT rescue, 33 L412V rescue, and 31 Y502C rescue. (f) Representative confocal images and (g) the quantification of spine density in cultured hippocampal neurons transfected with different tomosyn constructs as described in b, c, d, and e. Scale bar, 2 µm. #### p < 0.0001 when compared to scramble; **** p < 0.0001 when compared to shTomosyn, one‐way ANOVA with Dunnett's multiple comparison tests. n = 31 scramble, 30 shTomosyn, 29 WT rescue, 31 L412V rescue, and 31 Y502C rescue. (h) A reduction of GluR1 surface expression in dendritic segments in neurons co‐expressing shTomosyn‐L412V r ‐Tom‐RFP, compared to shTomosyn‐WT r ‐Tom‐RFP, was observed. ** p < 0.01 when compared to shTomosyn; ## p < 0.01, ### p < 0.001 when compared to shTomosyn‐L412V r ‐Tom‐RFP by one‐way ANOVA with Tukey's multiple comparisons test. n = 28 scramble, 21 shTomosyn, 22 WT rescue, 24 L412V rescue, 20 Y502C rescue

Article Snippet: The shRNA‐resistant tomosyn (wild‐type WT r ‐Tom‐GFP, L412V r ‐Tom‐GFP, and Y502C r ‐Tom‐GFP) constructs were made by mutating three nucleotides in the shTomosyn sequences with two PCR primers: Forward 5′‐AGTGGCTCTATGTGGGCACGGAACGCGGAAACATACACATTGTTA‐3′ and Reverse 5′‐TAACAATGTGTATGTTTCCGCGTTCCGTGCCCACATAGAGCCACT‐3′. shTomosyn‐WT r ‐Tom‐RFP, shTomosyn‐L412V r ‐Tom‐RFP, and shTomosyn‐Y502C r ‐Tom‐RFP were generated by inserting WT r ‐Tom, L412V r ‐Tom, or Y502C r ‐Tom into the shTomosyn vector. pcDNA3‐EGFP‐RhoA‐WT (Addgene, plasmid # 12965) and pcDNA3‐EGFP‐RhoA‐T19N (Addgene, plasmid # 12967) were gifts from Gary Bokoch (Subauste et al., ). pCI‐SEP‐GluR1 (Addgene, plasmid #24000) was a gift from Robert Malinow (Kopec, Li, Wei, Boehm, & Malinow, ). pTriEx‐RhoA FLARE.sc Biosensor WT (Addgene, plasmid # 12150) was a gift from Klaus Hahn (Pertz, Hodgson, Klemke, & Hahn, ). pCAGIG (IRES‐GFP; Addgene, plasmid # 11159) was a gift from Connie Cepko (Matsuda & Cepko, ). pRFP‐N1 was constructed by replacing GFP in the pEGFP‐N1 (Clontech, Catalog # 6085‐1) with RFP.

Techniques: Mutagenesis, Knockdown, Transfection, shRNA, Cell Culture, Construct, Comparison, Expressing